| Accession | MI0012692 | ||||
| Name | eca-mir-183 | ||||
| similar to following miRCarta precursors | eca-24617.1 | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chr4:84,472,003-84,472,071 (-) |
||||
| miRNA | eca-miR-183 | ||||
| Sequence (5' -> 3') (69 nts) |
CUGUGUAUGGCACUGGUAGAAUUCACUGUGAACAGUCUCGGUCAGUGAAUUACCGAAGGGCCAUAAACA | ||||
| MFE | -23.00 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
eca-mir-182
eca-mir-96 eca-mir-183 |
||||
| Family | mir-183 (MIPF0000066) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |