| Accession | MI0012672 | ||||
| Name | eca-mir-30e | ||||
| similar to following miRCarta precursors | eca-24.1 | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chr2:17,435,650-17,435,741 (-) |
||||
| miRNA | eca-miR-30e | ||||
| Sequence (5' -> 3') (92 nts) |
GGGCAGUCUUUGCUACUGUAAACAUCCUUGACUGGAAGCUGUAAGGUGUUCAGAGGAGCUUUCAGUCGGAUGUUUACAGCGGCAGGCUGCCA | ||||
| MFE | -51.80 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
eca-mir-30c
eca-mir-30e |
||||
| Family | mir-30 (MIPF0000005) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |