| Accession | MI0012668 | ||||
| Name | eca-mir-302b | ||||
| similar to following miRCarta precursors | eca-24441.1 | ||||
| Organism | Equus caballus | ||||
| Genome | Equ Cab 2 | ||||
| Location |
chr2:113,629,063-113,629,138 (+) |
||||
| miRNA | eca-miR-302b | ||||
| Sequence (5' -> 3') (76 nts) |
ACUCUCUUUAACUUUAACAUGGACGUGCUUUCUGUGACUUGCAAAAUAGUAAGUGCUUCCAUGUUUUAGUAGAAGU | ||||
| MFE | -25.20 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (5 precursors) |
eca-mir-302b eca-mir-302c eca-mir-302a eca-mir-302d eca-mir-367 |
||||
| Family | mir-302 (MIPF0000071) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Zhou et al. | Genomics | 2009 | 19406225 | In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. |