| Accession | MI0012531 | ||||||
| Name | mmu-mir-664 | ||||||
| similar to following miRCarta precursors | mmu-24213-24212.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr1:185,242,975-185,243,043 (+) |
||||||
| miRNA | mmu-miR-664-5p | ||||||
| miRNA | mmu-miR-664-3p | ||||||
| Sequence (5' -> 3') (69 nts) |
CUGGCUGGGGAAAAUGACUGGAUAGAAAACAUUAUUCUAUUCAUUUACUCCCCAGCCUACACAUGAAAG | ||||||
| MFE | -28.10 kcal/mol | ||||||
| first miRBase version | 14.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (1 precursors) |
mmu-mir-664 |
||||||
| Family | mir-664 (MIPF0000300) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Artzi et al. | BMC Bioinformatics | 2008 | 18215311 | miRNAminer: a tool for homologous microRNA gene search. |
| 2 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 3 | Zhu et al. | J. Virol. | 2010 | 20668074 | Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68. |