| Accession | MI0003823 | ||||
| Name | hsa-mir-449c | ||||
| similar to following miRCarta precursors | hsa-882-1478.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr5:55,172,262-55,172,353 (-) |
||||
| miRNA | hsa-miR-449c-5p | ||||
| miRNA | hsa-miR-449c-3p | ||||
| Sequence (5' -> 3') (92 nts) |
GCUGGGAUGUGUCAGGUAGGCAGUGUAUUGCUAGCGGCUGUUAAUGAUUUUAACAGUUGCUAGUUGCACUCCUCUCUGUUGCAUUCAGAAGC | ||||
| MFE | -44.60 kcal/mol | ||||
| first miRBase version | 14.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
hsa-mir-449a
hsa-mir-449b hsa-mir-449c |
||||
| Family | mir-449 (MIPF0000133) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
| 2 | Wyman et al. | PLoS ONE | 2009 | 19390579 | Repertoire of microRNAs in epithelial ovarian cancer as determined by next generation sequencing of small RNA cDNA libraries. |