| Accession | MI0010682 | ||||||||
| Name | ssc-mir-1 | ||||||||
| similar to following miRCarta precursors | ssc-24389.1 | ||||||||
| Organism | Sus scrofa | ||||||||
| Genome | Sscrofa10.2 | ||||||||
| Location |
chr17:69,285,393-69,285,500 (-) |
||||||||
| miRNA | ssc-miR-1 | ||||||||
| Sequence (5' -> 3') (108 nts) |
CCGGUUGACGUACCUGCUUGGGGGACAUACUUCUUUAUGUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUUUCAGGCUGGGAACUCUCACCGG | ||||||||
| MFE | -44.90 kcal/mol | ||||||||
| first miRBase version | 13.0 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (1 precursors) |
ssc-mir-1 |
||||||||
| Family | mir-1 (MIPF0000038) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Reddy et al. | BMC Genomics | 2009 | 19196471 | Cloning, characterization and expression analysis of porcine microRNAs. |
| 2 | Cho et al. | Mol. Biol. Rep. | 2010 | 20180025 | Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue. |
| 3 | Nielsen et al. | Anim. Genet. | 2010 | 19917043 | MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing. |
| 4 | Li et al. | J. Cell. Biochem. | 2011 | 21312241 | MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing. |
| 5 | Chen et al. | BMC Genomics | 2014 | 24499489 | Exploration of microRNAs in porcine milk exosomes. |