Precursor miRBase

ssc-mir-1 (MI0010682)

Accession MI0010682
Name ssc-mir-1
similar to following miRCarta precursors ssc-24389.1
Organism Sus scrofa
Genome Sscrofa10.2
Location chr17:69,285,393-69,285,500 (-)
miRNA ssc-miR-1
Sequence (5' -> 3')
(108 nts)
CCGGUUGACGUACCUGCUUGGGGGACAUACUUCUUUAUGUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUUUCAGGCUGGGAACUCUCACCGG
MFE -44.90 kcal/mol
first miRBase version 13.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ssc-mir-1
Family mir-1 (MIPF0000038)
Experiments
experiment Pubmed link
Illumina 21312241 24499489 19917043
cloned 20180025
454 19196471
External DBs
Gene symbol MIR1
NCBI Gene 100316581

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Reddy et al. BMC Genomics 2009 19196471 Cloning, characterization and expression analysis of porcine microRNAs.
2 Nielsen et al. Anim. Genet. 2010 19917043 MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing.
3 Cho et al. Mol. Biol. Rep. 2010 20180025 Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue.
4 Li et al. J. Cell. Biochem. 2011 21312241 MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing.
5 Chen et al. BMC Genomics 2014 24499489 Exploration of microRNAs in porcine milk exosomes.