| Accession | MI0010527 |
| Name | bfl-mir-219 |
| similar to following miRCarta precursors | bfl-860.1 |
| Organism | Branchiostoma floridae |
| Genome | JGI2.0 |
| Location |
Bf_V2_250:1,137,875-1,137,956 (+) |
| miRNA | bfl-miR-219 |
| Sequence (5' -> 3') (82 nts) |
CCAGUGCUGAUUGUCCAAACGCAAUUCUUGUUGACCUUUGAACCAAGAACUGCGCUGGACAUCAGCAAUUGACGCUGCCUAC |
| MFE | -30.00 kcal/mol |
| first miRBase version | 13.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (1 precursors) |
bfl-mir-219 |
| Family | mir-219 (MIPF0000044) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wheeler et al. | Evol. Dev. | 2009 | 19196333 | The deep evolution of metazoan microRNAs. |
| 2 | Dai et al. | Evol. Dev. | 2009 | 19196332 | Characterization of microRNAs in cephalochordates reveals a correlation between microRNA repertoire homology and morphological similarity in chordate evolution. |