| Accession | MI0010018 | ||||||
| Name | bfl-mir-33-2 | ||||||
| similar to following miRCarta precursors | bfl-257.2 | ||||||
| Organism | Branchiostoma floridae | ||||||
| Genome | JGI2.0 | ||||||
| Location |
Bf_V2_21:4,947,944-4,948,030 (-) |
||||||
| miRNA | bfl-miR-33 | ||||||
| Sequence (5' -> 3') (87 nts) |
ACACCUGUUGCUAGGGUGCAUUGUAGUUGCAUUGCAUGUGCAACACAGAAGUGCAAUGUAACUGCAGUGCAGCCCAGAGGCAGGAAC | ||||||
| MFE | -48.20 kcal/mol | ||||||
| first miRBase version | 13.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
bfl-mir-33-1
bfl-mir-33-2 |
||||||
| Family | mir-33 (MIPF0000070) | ||||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wheeler et al. | Evol. Dev. | 2009 | 19196333 | The deep evolution of metazoan microRNAs. |
| 2 | Dai et al. | Evol. Dev. | 2009 | 19196332 | Characterization of microRNAs in cephalochordates reveals a correlation between microRNA repertoire homology and morphological similarity in chordate evolution. |