| Accession | MI0010516 | ||||
| Name | bfl-let-7a-1 | ||||
| similar to following miRCarta precursors | bfl-40038-40037.1 | ||||
| Organism | Branchiostoma floridae | ||||
| Genome | JGI2.0 | ||||
| Location |
Bf_V2_28:2,706,001-2,706,082 (+) |
||||
| miRNA | bfl-let-7a-5p | ||||
| miRNA | bfl-let-7a-3p | ||||
| Sequence (5' -> 3') (82 nts) |
CUGAGGUGAGGUAGUAGGUUGUAUAGUUCAGAAGUACAACAUUGGAGAUGACUGUACAACCCGUUACCUUUUUUUGGGUCAU | ||||
| MFE | -26.50 kcal/mol | ||||
| first miRBase version | 13.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
bfl-mir-100
bfl-let-7a-1 bfl-let-7b bfl-mir-125a bfl-mir-125b bfl-let-7a-2 |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Dai et al. | Evol. Dev. | 2009 | 19196332 | Characterization of microRNAs in cephalochordates reveals a correlation between microRNA repertoire homology and morphological similarity in chordate evolution. |
| 2 | Campo-Paysaa et al. | Evol. Dev. | 2011 | 21210939 | microRNA complements in deuterostomes: origin and evolution of microRNAs. |