| Accession | MI0009992 | ||||||
| Name | mmu-mir-1981 | ||||||
| similar to following miRCarta precursors | mmu-24211-24210.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr1:184,822,407-184,822,488 (-) |
||||||
| miRNA | mmu-miR-1981-5p | ||||||
| miRNA | mmu-miR-1981-3p | ||||||
| Sequence (5' -> 3') (82 nts) |
GUAAAGGCUGGGCUUAGACGUGGCCUUUGGGUGUGGAAUGCACUUCCGUUUGUAACCGCCAUCUAACCCUGGCCUUUGACAG | ||||||
| MFE | -30.30 kcal/mol | ||||||
| first miRBase version | 13.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (1 precursors) |
mmu-mir-1981 |
||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Babiarz et al. | Genes Dev. | 2008 | 18923076 | Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAs. |
| 2 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 3 | Zhu et al. | J. Virol. | 2010 | 20668074 | Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68. |