| Accession | MI0009858 | ||||||
| Name | bta-mir-541 | ||||||
| similar to following miRCarta precursors | bta-27901.1 | ||||||
| Organism | Bos taurus | ||||||
| Genome | UMD3.1 | ||||||
| Location |
chr21:67,602,344-67,602,427 (+) |
||||||
| miRNA | bta-miR-541 | ||||||
| Sequence (5' -> 3') (84 nts) |
ACGUCAGGGAAAGGAUUCUGCUGUCGGUCCCACUCCAAAGUUCAAAAAAUGGGUGGUGGGCACAGAAUCCGGCCUCUGCUUGUG | ||||||
| MFE | -31.10 kcal/mol | ||||||
| first miRBase version | 13.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (17 precursors) |
bta-mir-3578
bta-mir-382 bta-mir-134 bta-mir-485 bta-mir-453 bta-mir-154a bta-mir-154b bta-mir-496 bta-mir-377 bta-mir-541 bta-mir-3957 bta-mir-409a bta-mir-409b bta-mir-412 bta-mir-369 bta-mir-410 bta-mir-656 |
||||||
| Family | mir-541 (MIPF0000213) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Artzi et al. | BMC Bioinformatics | 2008 | 18215311 | miRNAminer: a tool for homologous microRNA gene search. |
| 2 | Strozzi et al. | Anim. Genet. | 2009 | 18945293 | Annotation of 390 bovine miRNA genes by sequence similarity with other species. |
| 3 | Tesfaye et al. | Mol. Reprod. Dev. | 2009 | 19170227 | Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach. |