Accession | MI0009851 | ||||
Name | bta-mir-500 | ||||
similar to following miRCarta precursors | bta-345.1 | ||||
Organism | Bos taurus | ||||
Genome | UMD3.1 | ||||
Location |
chrX:92,899,698-92,899,781 (+) |
||||
miRNA | bta-miR-500 | ||||
Sequence (5' -> 3') (84 nts) |
GCUCCCCCUCUCUAAUCCUUGCUACCUGGGUGAGAGUGCUUUCUGAAUGCAAUGCACCUGGGCAAGGAUUCUGAGAGAGGGAGC | ||||
MFE | -44.90 kcal/mol | ||||
first miRBase version | 13.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (6 precursors) |
bta-mir-502a-2
bta-mir-502b bta-mir-362 bta-mir-500 bta-mir-660 bta-mir-502a-1 |
||||
Family | mir-500 (MIPF0000139) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Artzi et al. | BMC Bioinformatics | 2008 | 18215311 | miRNAminer: a tool for homologous microRNA gene search. |
2 | Strozzi et al. | Anim. Genet. | 2009 | 18945293 | Annotation of 390 bovine miRNA genes by sequence similarity with other species. |
3 | Jin et al. | BMC Mol. Biol. | 2009 | 19758457 | Characterization of bovine miRNAs by sequencing and bioinformatics analysis. |
4 | Long et al. | Biochem. Genet. | 2009 | 19267191 | Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning. |