| Accession | MI0009843 | ||||
| Name | bta-mir-486 | ||||
| similar to following miRCarta precursors | bta-27985.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr27:36,261,818-36,261,941 (-) |
||||
| miRNA | bta-miR-486 | ||||
| Sequence (5' -> 3') (124 nts) |
GCCAGCUUGGACCUGCGUCCUCCCUGACGGGUCCUGUACUGAGCUGCCCCGAGGCCCUUCGCUGUGCCCAGCUCGGGUCAGCUCAGUACCGGGCGCGUCGGGGUGGGAGUCGGCCGGAAGCAGG | ||||
| MFE | -75.10 kcal/mol | ||||
| first miRBase version | 13.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
bta-mir-486 |
||||
| Family | mir-486 (MIPF0000220) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Artzi et al. | BMC Bioinformatics | 2008 | 18215311 | miRNAminer: a tool for homologous microRNA gene search. |
| 2 | Strozzi et al. | Anim. Genet. | 2009 | 18945293 | Annotation of 390 bovine miRNA genes by sequence similarity with other species. |
| 3 | Jin et al. | BMC Mol. Biol. | 2009 | 19758457 | Characterization of bovine miRNAs by sequencing and bioinformatics analysis. |