Precursor miRBase

bta-mir-335 (MI0009804)

Accession MI0009804
Name bta-mir-335
similar to following miRCarta precursors bta-249.1
Organism Bos taurus
Genome UMD3.1
Location chr4:95,070,993-95,071,084 (+)
miRNA bta-miR-335
Sequence (5' -> 3')
(92 nts)
UUUUGGGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUGACCUCCUCUCAUUUGCUGUACUCA
MFE -39.30 kcal/mol
first miRBase version 13.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
bta-mir-335
Family mir-335 (MIPF0000196)
Experiments
experiment Pubmed link
cloned 19267191
External DBs
Gene symbol MIR335
NCBI Gene 100313352

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Artzi et al. BMC Bioinformatics 2008 18215311 miRNAminer: a tool for homologous microRNA gene search.
2 Strozzi et al. Anim. Genet. 2009 18945293 Annotation of 390 bovine miRNA genes by sequence similarity with other species.
3 Long et al. Biochem. Genet. 2009 19267191 Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning.