Precursor miRBase

bta-mir-29d (MI0009788)

Accession MI0009788
Name bta-mir-29d
similar to following miRCarta precursors bta-223-27771.1
Organism Bos taurus
Genome UMD3.1
Location chr16:77,562,538-77,562,625 (+)
miRNA bta-miR-29d-5p
miRNA bta-miR-29d-3p
Sequence (5' -> 3')
(88 nts)
AUCUCUUACACAGGCUGACCGAUUUCUCCUGGUGUUCAGAGUCUGUUUUUGUCUAGCACCAUUUGAAAUCGAUUAUGAUGUAGGGGGA
MFE -28.10 kcal/mol
first miRBase version 13.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
bta-mir-29e
bta-mir-29d
Family mir-29 (MIPF0000009)
Experiments
experiment Pubmed link
Illumina 23100578
External DBs
Gene symbol MIR29D
NCBI Gene 100313025

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Strozzi et al. Anim. Genet. 2009 18945293 Annotation of 390 bovine miRNA genes by sequence similarity with other species.
2 Jin et al. BMC Mol. Biol. 2009 19758457 Characterization of bovine miRNAs by sequencing and bioinformatics analysis.
3 Muroya et al. J. Anim. Sci. 2013 23100578 Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing.