| Accession | MI0009788 | ||||
| Name | bta-mir-29d | ||||
| similar to following miRCarta precursors | bta-223-27771.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr16:77,562,538-77,562,625 (+) |
||||
| miRNA | bta-miR-29d-5p | ||||
| miRNA | bta-miR-29d-3p | ||||
| Sequence (5' -> 3') (88 nts) |
AUCUCUUACACAGGCUGACCGAUUUCUCCUGGUGUUCAGAGUCUGUUUUUGUCUAGCACCAUUUGAAAUCGAUUAUGAUGUAGGGGGA | ||||
| MFE | -28.10 kcal/mol | ||||
| first miRBase version | 13.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
bta-mir-29e
bta-mir-29d |
||||
| Family | mir-29 (MIPF0000009) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Jin et al. | BMC Mol. Biol. | 2009 | 19758457 | Characterization of bovine miRNAs by sequencing and bioinformatics analysis. |
| 2 | Strozzi et al. | Anim. Genet. | 2009 | 18945293 | Annotation of 390 bovine miRNA genes by sequence similarity with other species. |
| 3 | Muroya et al. | J. Anim. Sci. | 2013 | 23100578 | Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing. |