Precursor miRBase

bta-mir-223 (MI0009782)

Accession MI0009782
Name bta-mir-223
similar to following miRCarta precursors bta-120.1
Organism Bos taurus
Genome UMD3.1
Location chrX:99,936,305-99,936,412 (-)
miRNA bta-miR-223
Sequence (5' -> 3')
(108 nts)
CCCAGCCUCCUGCAGUGCCAUGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCCAUGUAGUAGUGUCAGUUUGUCAAAUACCCCAAGUGUGGCAUAUGCCUAGCAG
MFE -41.00 kcal/mol
first miRBase version 13.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
bta-mir-223
Family mir-223 (MIPF0000067)
Experiments
experiment Pubmed link
cloned 19758457
qRT-PCR 19170227
microarray 19170227
External DBs
Gene symbol MIR223
NCBI Gene 100313022

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Artzi et al. BMC Bioinformatics 2008 18215311 miRNAminer: a tool for homologous microRNA gene search.
2 Strozzi et al. Anim. Genet. 2009 18945293 Annotation of 390 bovine miRNA genes by sequence similarity with other species.
3 Jin et al. BMC Mol. Biol. 2009 19758457 Characterization of bovine miRNAs by sequencing and bioinformatics analysis.
4 Tesfaye et al. Mol. Reprod. Dev. 2009 19170227 Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach.