| Accession | MI0009780 | ||||
| Name | bta-mir-218-1 | ||||
| similar to following miRCarta precursors | bta-185.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr6:41,545,029-41,545,138 (+) |
||||
| miRNA | bta-miR-218 | ||||
| Sequence (5' -> 3') (110 nts) |
GUGGUUAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCCAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA | ||||
| MFE | -44.90 kcal/mol | ||||
| first miRBase version | 13.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
bta-mir-218-1 |
||||
| Family | mir-218 (MIPF0000026) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 2 | Strozzi et al. | Anim. Genet. | 2009 | 18945293 | Annotation of 390 bovine miRNA genes by sequence similarity with other species. |
| 3 | Jin et al. | BMC Mol. Biol. | 2009 | 19758457 | Characterization of bovine miRNAs by sequencing and bioinformatics analysis. |
| 4 | Long et al. | Biochem. Genet. | 2009 | 19267191 | Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning. |