| Accession | MI0009772 | ||||||||
| Name | bta-mir-206 | ||||||||
| similar to following miRCarta precursors | bta-817.1 | ||||||||
| Organism | Bos taurus | ||||||||
| Genome | UMD3.1 | ||||||||
| Location |
chr23:24,308,042-24,308,127 (+) |
||||||||
| miRNA | bta-miR-206 | ||||||||
| Sequence (5' -> 3') (86 nts) |
UGCUUCCCAAGGCCACAUGCUUCUUUAUAUCCCCAUACGGAUUACUUUGCUAUGGAAUGUAAGGAAGUGUGUGGUUUCGGCGAGCG | ||||||||
| MFE | -41.00 kcal/mol | ||||||||
| first miRBase version | 13.0 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (2 precursors) |
bta-mir-206 bta-mir-133b |
||||||||
| Family | mir-1 (MIPF0000038) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Artzi et al. | BMC Bioinformatics | 2008 | 18215311 | miRNAminer: a tool for homologous microRNA gene search. |
| 2 | Strozzi et al. | Anim. Genet. | 2009 | 18945293 | Annotation of 390 bovine miRNA genes by sequence similarity with other species. |
| 3 | Jin et al. | BMC Mol. Biol. | 2009 | 19758457 | Characterization of bovine miRNAs by sequencing and bioinformatics analysis. |
| 4 | Tesfaye et al. | Mol. Reprod. Dev. | 2009 | 19170227 | Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach. |