| Accession | MI0009749 | ||||||
| Name | bta-mir-153-1 | ||||||
| similar to following miRCarta precursors | bta-27482.1 | ||||||
| Organism | Bos taurus | ||||||
| Genome | UMD3.1 | ||||||
| Location |
chr2:107,963,022-107,963,111 (-) |
||||||
| miRNA | bta-miR-153 | ||||||
| Sequence (5' -> 3') (90 nts) |
CUCACGGCUGCCAGCGUCAUUUUUGUGAUCUGCAGCUAGUAUUCUCACUCCAGUUGCAUAGUCACAAAAGUGAUCACUGGCAGGUGUGGC | ||||||
| MFE | -46.20 kcal/mol | ||||||
| first miRBase version | 13.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (1 precursors) |
bta-mir-153-1 |
||||||
| Family | mir-153 (MIPF0000050) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Artzi et al. | BMC Bioinformatics | 2008 | 18215311 | miRNAminer: a tool for homologous microRNA gene search. |
| 2 | Strozzi et al. | Anim. Genet. | 2009 | 18945293 | Annotation of 390 bovine miRNA genes by sequence similarity with other species. |
| 3 | Tesfaye et al. | Mol. Reprod. Dev. | 2009 | 19170227 | Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach. |