Accession | MI0009733 | ||||
Name | bta-mir-133a-1 | ||||
similar to following miRCarta precursors | bta-320.1 | ||||
Organism | Bos taurus | ||||
Genome | UMD3.1 | ||||
Location |
chr13:55,227,292-55,227,386 (-) |
||||
miRNA | bta-miR-133a | ||||
Sequence (5' -> 3') (95 nts) |
UGGGACCGAAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCAACUGUUCGAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUGCGCAUUGAU | ||||
MFE | -34.00 kcal/mol | ||||
first miRBase version | 13.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
bta-mir-133c
bta-mir-133a-1 |
||||
Family | mir-133 (MIPF0000029) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Artzi et al. | BMC Bioinformatics | 2008 | 18215311 | miRNAminer: a tool for homologous microRNA gene search. |
2 | Strozzi et al. | Anim. Genet. | 2009 | 18945293 | Annotation of 390 bovine miRNA genes by sequence similarity with other species. |
3 | Jin et al. | BMC Mol. Biol. | 2009 | 19758457 | Characterization of bovine miRNAs by sequencing and bioinformatics analysis. |