Accession | MI0009730 | ||||
Name | bta-mir-130a | ||||
similar to following miRCarta precursors | bta-139.1 | ||||
Organism | Bos taurus | ||||
Genome | UMD3.1 | ||||
Location |
chr15:82,197,711-82,197,799 (+) |
||||
miRNA | bta-miR-130a | ||||
Sequence (5' -> 3') (89 nts) |
UGCUGCGGGCCGGAGCUCUUUUCACAUUGUGCUACUGUCUGCGCCUGUCACUAGCAGUGCAAUGUUAAAAGGGCAUUGGCUGUGCAGCG | ||||
MFE | -42.70 kcal/mol | ||||
first miRBase version | 13.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
bta-mir-130a |
||||
Family | mir-130 (MIPF0000034) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Artzi et al. | BMC Bioinformatics | 2008 | 18215311 | miRNAminer: a tool for homologous microRNA gene search. |
2 | Strozzi et al. | Anim. Genet. | 2009 | 18945293 | Annotation of 390 bovine miRNA genes by sequence similarity with other species. |
3 | Jin et al. | BMC Mol. Biol. | 2009 | 19758457 | Characterization of bovine miRNAs by sequencing and bioinformatics analysis. |