| Accession | MI0010464 | ||||||||
| Name | bta-mir-29b-1 | ||||||||
| similar to following miRCarta precursors | bta-82.1 | ||||||||
| Organism | Bos taurus | ||||||||
| Genome | UMD3.1 | ||||||||
| Location |
chr4:95,402,694-95,402,774 (-) |
||||||||
| miRNA | bta-miR-29b | ||||||||
| Sequence (5' -> 3') (81 nts) |
CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG | ||||||||
| MFE | -34.10 kcal/mol | ||||||||
| first miRBase version | 13.0 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (2 precursors) |
bta-mir-29a
bta-mir-29b-1 |
||||||||
| Family | mir-29 (MIPF0000009) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 2 | Strozzi et al. | Anim. Genet. | 2009 | 18945293 | Annotation of 390 bovine miRNA genes by sequence similarity with other species. |
| 3 | Jin et al. | BMC Mol. Biol. | 2009 | 19758457 | Characterization of bovine miRNAs by sequencing and bioinformatics analysis. |
| 4 | Tesfaye et al. | Mol. Reprod. Dev. | 2009 | 19170227 | Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach. |