| Accession | MI0008571 | ||||
| Name | ptr-mir-199a-1 | ||||
| similar to following miRCarta precursors | ptr-47.2 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
19:11,024,938-11,025,007 (-) |
||||
| miRNA | ptr-miR-199a-3p | ||||
| Sequence (5' -> 3') (70 nts) |
GCCAACCCAGUGUUCAGACUACCUGUUCAGGAGGCUCUCAAUGUGUACAGUAGUCUGCACAUUGGUUAGG | ||||
| MFE | -25.30 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
ptr-mir-199a-1 |
||||
| Family | mir-199 (MIPF0000040) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |