| Accession | MI0009677 |
| Name | dya-mir-287 |
| similar to following miRCarta precursors | dya-42777.1 |
| Organism | Drosophila yakuba |
| Genome | dyak_caf1 |
| Location |
chr2R:3,525,130-3,525,206 (-) |
| miRNA | dya-miR-287 |
| Sequence (5' -> 3') (77 nts) |
GUAUGGGUGUGGGUCUGAAAUUUUGCACACAUUUACAGUAAUUGUAAAUGUGUUGAAAAUCGUUUGCAUGACUGUGA |
| MFE | -19.30 kcal/mol |
| first miRBase version | 12.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
dya-mir-287 dya-mir-124 |
| Family | mir-287 (MIPF0000224) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Drosophila 12 Genomes Consortium et al. | Nature | 2007 | 17994087 | Evolution of genes and genomes on the Drosophila phylogeny. |