Accession | MI0009624 |
Name | dwi-mir-288 |
similar to following miRCarta precursors | dwi-34598.1 |
Organism | Drosophila willistoni |
Genome | dwil_r1.3_FB2010_02 |
Location |
scf2_1100000004521:2,031,457-2,031,550 (-) |
miRNA | dwi-miR-288 |
Sequence (5' -> 3') (94 nts) |
CAGGUCGUAAUUAGCAGCGCACAACAUUCGUCGGCGAUAAUUAAUGACGUUGGUCACGUUGGUUUCAUGUCGAUUUCAUUUCAUGACACGGCCG |
MFE | -19.70 kcal/mol |
first miRBase version | 12.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (2 precursors) |
dwi-mir-133
dwi-mir-288 |
Family | mir-288 (MIPF0000223) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Drosophila 12 Genomes Consortium et al. | Nature | 2007 | 17994087 | Evolution of genes and genomes on the Drosophila phylogeny. |