| Accession | MI0009601 |
| Name | dwi-mir-9a |
| similar to following miRCarta precursors | dwi-31804.1 |
| Organism | Drosophila willistoni |
| Genome | dwil_r1.3_FB2010_02 |
| Location |
scf2_1100000004540:842,233-842,310 (+) |
| miRNA | dwi-miR-9a |
| Sequence (5' -> 3') (78 nts) |
GCUAUGUUGUCUUUGGUUAUCUAGCUGUAUGAGUGAUACAUAACGUCAUAAAGCUAGCUUACCGAAGUUAAUAUUAGC |
| MFE | -28.50 kcal/mol |
| first miRBase version | 12.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (1 precursors) |
dwi-mir-9a |
| Family | mir-9 (MIPF0000014) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Drosophila 12 Genomes Consortium et al. | Nature | 2007 | 17994087 | Evolution of genes and genomes on the Drosophila phylogeny. |