Accession | MI0009468 |
Name | dsi-mir-133 |
similar to following miRCarta precursors | dsi-26270.1 |
Organism | Drosophila simulans |
Genome | dsim_caf1 |
Location |
chr2L:20,179,937-20,180,027 (+) |
miRNA | dsi-miR-133 |
Sequence (5' -> 3') (91 nts) |
CUGCAACGCUGUGUGUAGCUGGUUGACAUCGGGUCAGAUCUGUUUUUUAAGCAUUUGGUCCCCUUCAACCAGCUGUAGCCAGUGGUUGCUG |
MFE | -40.00 kcal/mol |
first miRBase version | 12.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (2 precursors) |
dsi-mir-133 dsi-mir-288 |
Family | mir-133 (MIPF0000029) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Drosophila 12 Genomes Consortium et al. | Nature | 2007 | 17994087 | Evolution of genes and genomes on the Drosophila phylogeny. |