| Accession | MI0009466 |
| Name | dsi-mir-287 |
| similar to following miRCarta precursors | dsi-34579.1 |
| Organism | Drosophila simulans |
| Genome | dsim_caf1 |
| Location |
chr2L:17,277,853-17,277,923 (+) |
| miRNA | dsi-miR-287 |
| Sequence (5' -> 3') (71 nts) |
UGUAGGGUCGGAAAUUUUGCACACAUUUACAAUAAUUGUAAAUGUGUUGAAAAUCGUUUGCACGACUGUGA |
| MFE | -20.50 kcal/mol |
| first miRBase version | 12.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
dsi-mir-124
dsi-mir-287 |
| Family | mir-287 (MIPF0000224) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Drosophila 12 Genomes Consortium et al. | Nature | 2007 | 17994087 | Evolution of genes and genomes on the Drosophila phylogeny. |