| Accession | MI0009454 |
| Name | dsi-mir-10 |
| similar to following miRCarta precursors | dsi-34764.1 |
| Organism | Drosophila simulans |
| Genome | dsim_caf1 |
| Location |
chr3R:2,666,360-2,666,436 (-) |
| miRNA | dsi-miR-10 |
| Sequence (5' -> 3') (77 nts) |
CCACGUCUACCCUGUAGAUCCGAAUUUGUUUUAUACUAGCUUUAAGGACAAAUUCGGUUCUAGAGAGGUUUGUGUGG |
| MFE | -31.40 kcal/mol |
| first miRBase version | 12.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (1 precursors) |
dsi-mir-10 |
| Family | mir-10 (MIPF0000033) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Drosophila 12 Genomes Consortium et al. | Nature | 2007 | 17994087 | Evolution of genes and genomes on the Drosophila phylogeny. |