| Accession | MI0009311 |
| Name | dpe-mir-10 |
| similar to following miRCarta precursors | dpe-34764.1 |
| Organism | Drosophila persimilis |
| Genome | dper_r1.3_FB2010_02 |
| Location |
scaffold_3:2,487,694-2,487,770 (+) |
| miRNA | dpe-miR-10 |
| Sequence (5' -> 3') (77 nts) |
CCACGUCUACCCUGUAGAUCCGAAUUUGUUUUACAUUAGCUUUAAGGACAAAUUCGGUUCUAGAGAGGUUUGUGUGG |
| MFE | -31.40 kcal/mol |
| first miRBase version | 12.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (1 precursors) |
dpe-mir-10 |
| Family | mir-10 (MIPF0000033) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Drosophila 12 Genomes Consortium et al. | Nature | 2007 | 17994087 | Evolution of genes and genomes on the Drosophila phylogeny. |