Accession | MI0009310 |
Name | dpe-mir-288 |
similar to following miRCarta precursors | dpe-34598.1 |
Organism | Drosophila persimilis |
Genome | dper_r1.3_FB2010_02 |
Location |
scaffold_1:9,142,380-9,142,475 (+) |
miRNA | dpe-miR-288 |
Sequence (5' -> 3') (96 nts) |
GGCCAUGUCGUAAUUAGCAGGGUACAGCGUUGCCGGCGAAAAUUAAUGACGUUGGUCACGUUGGUUUCAUGUCGAUUUCAUUUCAUGACACGGCCG |
MFE | -35.30 kcal/mol |
first miRBase version | 12.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (2 precursors) |
dpe-mir-288 dpe-mir-133 |
Family | mir-288 (MIPF0000223) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Drosophila 12 Genomes Consortium et al. | Nature | 2007 | 17994087 | Evolution of genes and genomes on the Drosophila phylogeny. |