| Accession | MI0008880 | ||||
| Name | ptr-mir-933 | ||||
| similar to following miRCarta precursors | ptr-1412.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
2B:179,626,790-179,626,865 (-) |
||||
| miRNA | ptr-miR-933 | ||||
| Sequence (5' -> 3') (76 nts) |
ACUUGGGUCAGUUCAGAGGUCCUCGGGGCGCGCGUCGAGUCAGCCGUGUGCGCAGGGAGACCUCUCCCACCCACAG | ||||
| MFE | -31.90 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
ptr-mir-933 |
||||
| Family | mir-933 (MIPF0000505) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |