| Accession | MI0008842 | ||||
| Name | ptr-mir-656 | ||||
| similar to following miRCarta precursors | ptr-690.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
14:100,763,398-100,763,474 (+) |
||||
| miRNA | ptr-miR-656 | ||||
| Sequence (5' -> 3') (77 nts) |
UGAAAUAGGUUGCCUGUGAGGUGUUCACUUUCUAUAUGAUGAAUAUUAUACAGUCAACCUCUUUCCGAUAUCGAAUC | ||||
| MFE | -23.00 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (8 precursors) |
ptr-mir-154
ptr-mir-496 ptr-mir-377 ptr-mir-409 ptr-mir-412 ptr-mir-369 ptr-mir-410 ptr-mir-656 |
||||
| Family | mir-154 (MIPF0000018) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |