| Accession | MI0008771 | ||||
| Name | ptr-mir-553 | ||||
| similar to following miRCarta precursors | ptr-2496.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
1:101,109,597-101,109,663 (+) |
||||
| miRNA | ptr-miR-553 | ||||
| Sequence (5' -> 3') (67 nts) |
UUCAAUUUUAUUUUAAAACGGUGAGAUUUUGUUUUGUCUGAGAAAAUCUCGCUGUUUUAGACUGAGG | ||||
| MFE | -25.20 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
ptr-mir-553 |
||||
| Family | mir-553 (MIPF0000487) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |