| Accession | MI0008741 | ||||
| Name | ptr-mir-532 | ||||
| similar to following miRCarta precursors | ptr-190.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
X:50,088,603-50,088,692 (+) |
||||
| miRNA | ptr-miR-532 | ||||
| Sequence (5' -> 3') (90 nts) |
GACUUGCUUUCUCUCCUCCAUGCCUUGAGUGUAGGACCGUUGGCAUCUUAAUUACCCUCCCACACCCAAGGCUUGCAGAAGAGCGAGCCU | ||||
| MFE | -30.80 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
ptr-mir-532 ptr-mir-188 ptr-mir-500-1 ptr-mir-362 ptr-mir-501 ptr-mir-500-2 |
||||
| Family | mir-188 (MIPF0000113) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |