| Accession | MI0008730 | ||||
| Name | ptr-mir-520h | ||||
| similar to following miRCarta precursors | ptr-895.2 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
19:58,650,839-58,650,927 (+) |
||||
| miRNA | ptr-miR-520h | ||||
| Sequence (5' -> 3') (89 nts) |
CCCACGCUGUGACCCUCUAGAGGAAGCACUUUCUGUUUGUUGUCUGAGAAAAAACAAAGUGCUUCCCUUUAGAGUGUUACCUUUUGGGA | ||||
| MFE | -37.40 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (7 precursors) |
ptr-mir-518d
ptr-mir-516b-1 ptr-mir-518a ptr-mir-517b-2 ptr-mir-520h ptr-mir-521-1 ptr-mir-522 |
||||
| Family | mir-515 (MIPF0000020) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |