| Accession | MI0008727 | ||||
| Name | ptr-mir-520e | ||||
| similar to following miRCarta precursors | ptr-950.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
19:58,583,877-58,583,962 (+) |
||||
| miRNA | ptr-miR-520e | ||||
| Sequence (5' -> 3') (86 nts) |
CUCCUGCUGUGACCCUCAAGAUGGAAGCAGUUUCUGUUGUCUGAAAGGAAAGAAAGUGCUUCCUUUUUGAGGGUUACUGUUUGAGA | ||||
| MFE | -43.60 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (8 precursors) |
ptr-mir-512
ptr-mir-1323 ptr-mir-498 ptr-mir-520e ptr-mir-515-1 ptr-mir-519e ptr-mir-520f ptr-mir-515-2 |
||||
| Family | mir-515 (MIPF0000020) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |