Accession | MI0008720 | ||||
Name | ptr-mir-519c | ||||
similar to following miRCarta precursors | ptr-890.1 | ||||
Organism | Pan troglodytes | ||||
Genome | CHIMP2.1.4 | ||||
Location |
19:58,594,657-58,594,742 (+) |
||||
miRNA | ptr-miR-519c | ||||
Sequence (5' -> 3') (86 nts) |
CUCAGCCUGUGACCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAGUGCAUCUUUUUAGAGGAUUACAGUUUGAGA | ||||
MFE | -43.60 kcal/mol | ||||
first miRBase version | 12.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (9 precursors) |
ptr-mir-515-1
ptr-mir-519e ptr-mir-520f ptr-mir-515-2 ptr-mir-519c ptr-mir-1283a ptr-mir-520a ptr-mir-526b ptr-mir-519b |
||||
Family | mir-515 (MIPF0000020) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |