| Accession | MI0008719 | ||||
| Name | ptr-mir-519b | ||||
| similar to following miRCarta precursors | ptr-938.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
19:58,603,358-58,603,437 (+) |
||||
| miRNA | ptr-miR-519b | ||||
| Sequence (5' -> 3') (80 nts) |
AUGCUGUGACCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAGUGCAUCCUUUUAGAGGUUUACUGUUUG | ||||
| MFE | -37.20 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (10 precursors) |
ptr-mir-519c
ptr-mir-1283a ptr-mir-520a ptr-mir-526b ptr-mir-519b ptr-mir-525 ptr-mir-523 ptr-mir-518f ptr-mir-520b ptr-mir-518b |
||||
| Family | mir-515 (MIPF0000020) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |