Accession | MI0008704 | ||||
Name | ptr-mir-515-2 | ||||
similar to following miRCarta precursors | ptr-930.1 ptr-930.2 | ||||
Organism | Pan troglodytes | ||||
Genome | CHIMP2.1.4 | ||||
Location |
19:58,593,186-58,593,267 (+) |
||||
miRNA | ptr-miR-515 | ||||
Sequence (5' -> 3') (82 nts) |
CUCAUGCAGUCAUUCUCCAAAAGAAAGCACUUUCUGUUGUCUGAAAGCAGAGUGCCUUCUUUUGGAGCGUUACUGUUUGAGA | ||||
MFE | -39.70 kcal/mol | ||||
first miRBase version | 12.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (9 precursors) |
ptr-mir-520e
ptr-mir-515-1 ptr-mir-519e ptr-mir-520f ptr-mir-515-2 ptr-mir-519c ptr-mir-1283a ptr-mir-520a ptr-mir-526b |
||||
Family | mir-515 (MIPF0000020) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |