| Accession | MI0008702 | ||||
| Name | ptr-mir-512 | ||||
| similar to following miRCarta precursors | ptr-849.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
19:58,574,800-58,574,882 (+) |
||||
| miRNA | ptr-miR-512 | ||||
| Sequence (5' -> 3') (83 nts) |
CUCAGUCUGUGGCACUCAGCCUUGAGGGCACUUUCUGGUGUCAGAAUGAAAGUGCUGUCAUAGCUGAGGUCCAAUGACUGAGG | ||||
| MFE | -47.50 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (4 precursors) |
ptr-mir-512 ptr-mir-1323 ptr-mir-498 ptr-mir-520e |
||||
| Family | mir-512 (MIPF0000518) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |