| Accession | MI0008697 | ||||
| Name | ptr-mir-502 | ||||
| similar to following miRCarta precursors | ptr-29004.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
X:50,100,321-50,100,405 (+) |
||||
| miRNA | ptr-miR-502 | ||||
| Sequence (5' -> 3') (85 nts) |
GCUCCCCCUCUCUAAUCCUUGCUAUCUGGGUGCUAGUGCUGGCUCAAUGCAAUGCACCUGGGCAAGGAUUCAGAGAGGGGGAGCU | ||||
| MFE | -57.00 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
ptr-mir-500-1
ptr-mir-362 ptr-mir-501 ptr-mir-500-2 ptr-mir-660 ptr-mir-502 |
||||
| Family | mir-500 (MIPF0000139) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |