| Accession | MI0008693 | ||||
| Name | ptr-mir-498 | ||||
| similar to following miRCarta precursors | ptr-952.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
19:58,582,355-58,582,478 (+) |
||||
| miRNA | ptr-miR-498 | ||||
| Sequence (5' -> 3') (124 nts) |
ACCCUCCCUUGGGAAGUGAAGCUCAGGCUGUGAUUUCAAGCCAGGGGGCGUUUUUCUAUAACUGGAUGAAAAGCACCUCCAGGGCUUGAAGCUCACAGUUUGAGAGCAAUCGUCUAAGGAAGUU | ||||
| MFE | -58.30 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (7 precursors) |
ptr-mir-512
ptr-mir-1323 ptr-mir-498 ptr-mir-520e ptr-mir-515-1 ptr-mir-519e ptr-mir-520f |
||||
| Family | mir-498 (MIPF0000463) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |