Accession | MI0008682 | ||||
Name | ptr-mir-486 | ||||
similar to following miRCarta precursors | ptr-107.1 | ||||
Organism | Pan troglodytes | ||||
Genome | CHIMP2.1.4 | ||||
Location |
8:38,135,696-38,135,762 (-) |
||||
miRNA | ptr-miR-486 | ||||
Sequence (5' -> 3') (67 nts) |
GCAUCCUGUACUGAGCUGCCCCGAGGCCCUUCAUGCUGCCCAGCUCGGGGCAGCUCAGUACAGGAUA | ||||
MFE | -48.60 kcal/mol | ||||
first miRBase version | 12.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
ptr-mir-486 |
||||
Family | mir-486 (MIPF0000220) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |