| Accession | MI0008670 | ||||
| Name | ptr-mir-449a | ||||
| similar to following miRCarta precursors | ptr-31094.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
5:60,321,328-60,321,417 (+) |
||||
| miRNA | ptr-miR-449a | ||||
| Sequence (5' -> 3') (90 nts) |
UGUGUGUGAUGAGCUGGCAGUGUAUUGUUAGCUCGUUGAAUAUGUGAAUGGCAUCGGCUAACAUGCAACUGCUGUCUUAUUGCAUAUACA | ||||
| MFE | -36.70 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
ptr-mir-449c
ptr-mir-449b ptr-mir-449a |
||||
| Family | mir-449 (MIPF0000133) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |