Accession | MI0008665 | ||||
Name | ptr-mir-425 | ||||
similar to following miRCarta precursors | ptr-95.1 | ||||
Organism | Pan troglodytes | ||||
Genome | CHIMP2.1.4 | ||||
Location |
3:49,784,765-49,784,850 (-) |
||||
miRNA | ptr-miR-425 | ||||
Sequence (5' -> 3') (86 nts) |
GAAAGCGCUUUGGAAUGACACGAUCACUCCCGUUGAGUGGGCACCCGAGAAGCCAUCGGGAAUGUCGUGUCCGCCCAGUGCUCUUU | ||||
MFE | -32.00 kcal/mol | ||||
first miRBase version | 12.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
ptr-mir-425 ptr-mir-191 |
||||
Family | mir-425 (MIPF0000242) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |