Accession | MI0008601 | ||||
Name | ptr-mir-302c | ||||
similar to following miRCarta precursors | ptr-845.1 | ||||
Organism | Pan troglodytes | ||||
Genome | CHIMP2.1.4 | ||||
Location |
4:115,285,101-115,285,167 (-) |
||||
miRNA | ptr-miR-302c | ||||
Sequence (5' -> 3') (67 nts) |
CCUUUGCUUUAACAUGGGGGUACCUGCUGUGUGAAACAAAAGUAAGUGCUUCCAUGUUUCAGUGGAG | ||||
MFE | -28.30 kcal/mol | ||||
first miRBase version | 12.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (5 precursors) |
ptr-mir-367
ptr-mir-302d ptr-mir-302a ptr-mir-302c ptr-mir-302b |
||||
Family | mir-302 (MIPF0000071) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |