| Accession | MI0008596 | ||||
| Name | ptr-mir-300 | ||||
| similar to following miRCarta precursors | ptr-1725.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
14:100,738,033-100,738,114 (+) |
||||
| miRNA | ptr-miR-300 | ||||
| Sequence (5' -> 3') (82 nts) |
GCUACUUGAAGAGAGGUAAUCCUUCAUGCAUUUGCUUUACUUGCAAUGAUUAUACAAGGGCAGACUCUCUCUGGGGAGCAAA | ||||
| MFE | -20.90 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (15 precursors) |
ptr-mir-495
ptr-mir-376c ptr-mir-376a-2 ptr-mir-654 ptr-mir-376b ptr-mir-376a-1 ptr-mir-300 ptr-mir-1185-1 ptr-mir-1185-2 ptr-mir-381 ptr-mir-487b ptr-mir-539 ptr-mir-889 ptr-mir-544 ptr-mir-655 |
||||
| Family | mir-154 (MIPF0000018) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |