| Accession | MI0008595 | ||||
| Name | ptr-mir-29c | ||||
| similar to following miRCarta precursors | ptr-51.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
1:186,884,378-186,884,464 (-) |
||||
| miRNA | ptr-miR-29c | ||||
| Sequence (5' -> 3') (87 nts) |
AUCUCUUACACAGGCUGACCGAUUUCUCCUGGUGUUCAGAGUCUGUUUUUGUCUAGCACCAUUUGAAAUCGGUUAUGAUGUAGGGGG | ||||
| MFE | -34.80 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
ptr-mir-29c ptr-mir-29b-2 |
||||
| Family | mir-29 (MIPF0000009) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |