| Accession | MI0008568 | ||||
| Name | ptr-mir-195 | ||||
| similar to following miRCarta precursors | ptr-191.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
17:7,071,157-7,071,242 (-) |
||||
| miRNA | ptr-miR-195 | ||||
| Sequence (5' -> 3') (86 nts) |
AGCUUCCCUGGCUCUAGCAGCACAGAAAUAUUGGCACAGGGAAGCGAGUCUGCCAAUAUUGGCUGUGCUGCUCCAGGCAGGGUGGU | ||||
| MFE | -46.10 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
ptr-mir-195 ptr-mir-497 |
||||
| Family | mir-15 (MIPF0000006) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |